CTT, 3 and 5, TGAAAGGCAAAT TCAAACAT, 3 94 5 min, 35 cycles of 94 30 s, 55 s followed at 30 and 72 for 30 s, by a final extension of 5 min at 72: The reactions were performed under the following conditions. The PCR products were separated chemical compound library on a 2% agarose gel and using a digital camera on a UV transilluminator to F Mounted staining with ethidium bromide brominde. The quality of t of GAPDH cDNA was amplified using primers. Real-time quantitative PCR. The H Height of MLN64 transcripts of the cDNA using a real-time quantitative PCR, modified based on technology Amplifluor from a previously described method. An additionally USEFUL sequence was designated one of the primers, the sequence as Z, the complementary R was added to the probe general Z The reaction carried out on IcyclerIQ The optical with a unit which shall enable real-time detection of 96 reactions.
The reaction conditions were: 94 12 min, 50 cycles of 94 15 seconds, 55 seconds for 40 and 72 for 20 seconds. Levels of the transcripts were of an internal standard, which generates amplified Phloridzin simultaneously with the samples. Construction of ribozyme transgene targeting human MLN64 and the establishment of corresponding stable transfectants. Anti-human MLN64 hammer ribozymes were con Us on the basis of the secondary Dimeric structure of the gene using the Zuker RNA MFold program. Ribozymes were synthesized accordingly and then TOPO vector pEF6/V5 your cloned. The ribozyme transgenes checked and empty plasmids were transfected into MCF-7 and MDAMB 231 cells, the easyJet each case by means of a multi electroporator.
After more than 14 days after the election, with 5 g / ml blasticidin the transfectants were tested in medium containing 0.5 Maintainence grown g / ml blasticidin. Primer sequences ribozymes were 5, CTG CAGGTGCGAGGAGAGGCTCTGGCTGTGGCTGATGA GTCCGTGAGGA 3 and 5, ACTAGTGGCCTCCCTGGTC CTCACTGTTTCGTCCTCACGGACT 3, test cell growth. The breast cancer cells were plated in 96-well plates at 3000 cells / well. The cells were fixed in 4% formalin on days 1, 3, 5 is fastened after plating. The cells were then found with 0.5% crystal violet Rbt. After washing, crystal violet was found Rbt with 10% extracted aceticFlow analysis of apoptosis by flow cytometry. Including all the cells The Lich floating in the culture medium were harvested after incubation.
The cells were washed in cold PBS and resuspended in 1 annexin binding buffer at a density of 1×106 cells / ml after centrifugation. FITC-annexin-V and 1 l PI Arbeitsl Solution were added to 100 l of cell suspension. After incubation for 15 min at room temperature were 400 l 1X annexin binding buffer was added, gently mixed and the samples were kept on ice. The found Rbten cells were immediately analyzed by flow cytometer and software Flowmax. Cellular matrix adhesion. The cells were added to each well of a 96-well plate, previously coated Matrigel was. After 40 min incubation, nonadherent cells were washed with BSS buffer. The remaining cells were fixed in formalin and found with crystal violet Fixed rabbit. The number of adh Pensions cells was then gez Hlt. When the effect on the adhesion Was examined sion of FAK, 10 nM FAK inhibitor was added to appropriate wells. In vitro test invasion. This has been achieved earlier than
Related posts:
- Chemical library screening expose the animals to the Feeder Lligkeiten core labor
- TW-37 cells expressing wild-type ERBB2 with the EGFR inhibitor erlotinib
- Aloe-emodin of IgM and IgG in Kulturberst Walls and the number of B cells
- Inhibiting synergy with both chlorambucil and fludarabine in inducing apoptosis of CLL cells