E. coli strains were grown at 37°C, P. luminescens TT01 and its derivatives at 28°C and P. asymbiotica at both temperatures depending on the assay. For pellicle assays [34] and biofilm in microscopy chambers (Ibidi) strains were grown statically in LB and Grace’s/Schneider’s insect media (Sigma). Amplification of the s1 gene from P. asymbiotica isolates was performed using the primers s1F: 5′TATGAATTCATAAGTAAGGAT 3′ and s1R: 5′ CGGTGTTTTAGTAAGCTTCTATCT 3′. Two-dimensional
gel electrophoresis, Western blot and Pam protein purification From a starting overnight culture (28°C) of P. asymbiotica ATCC43949, cultures were inoculated and grown for 24 h at 28°C and 37°C until early stationary phase. Proteins from both supernatants were phenol precipitated and resuspended in 150 μl CDU buffer (4% CHAPS, 130 mM DTT and 9 M Urea) containing {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| 1 × HALTTM protease Inhibitor Cocktail Mix (Pierce, Thermo Fisher, UK). Samples cancer metabolism inhibitor were incubated for 2 h at room temperature, then centrifuged for 30 min at 88 760 × g. The RediPlate Protein Quantitation Kit (Molecular Probes, Invitrogen, UK) was used to
quantify protein concentration in the samples and equivalent amounts of total proteins were loaded. A Multiphor II system (GE Healthcare, UK) was used for isoelectric focusing and horizontal SDS-polyacrylamide gel electrophoresis with Immobiline DryStrip gels and precast 12.5% SDS gels (GE Healthcare, UK), following the manufacturer’s instructions. Gels were Coomassie stained and protein spots were excised and sent to the protein sequencing facility at the University of the West of England (Bristol, UK). The peptide sequences resulting from MALDI analysis of trypsin-digested proteins, were compared to all proteins in the SwissProt non-redundant database and to a database of
predicted proteins from the P. asymbiotica ATCC43949 genome sequence [8]. A polyclonal anti-Pam antibody was raised in rabbits against the peptide KLIQDSIRLDQGEW (amino acid positions 28-41) from P. asymbiotica ATCC43949 by GenScript Corporation (USA). For Western blot, proteins were precipitated with 1/10 Oxymatrine volumes of 100% Trichloroacetic acid, separated by SDS-PAGE and transferred onto a Trans-Blot nitrocellulose membrane (BioRad, USA) using a Semi-Dry blotter (BioRad, USA). Nutlin-3a order Membranes were incubated with 1/500 dilution of the anti-Pam antibody for 90 min and with 1/5000 dilution of an anti-rabbit alkaline phosphatase conjugated secondary antibody for 90 min Alkaline phosphatase reaction with NBT-BCIP solution (Fluka, Sigma-Aldrich, USA) was used for development. To detect production of Pam in vivo, larvae of Galleria mellonella were injected with 20 μl of diluted overnight cultures of either P. luminescens TT01 or P. asymbiotica ATCC43949, corresponding to 200 CFU. Infected insects were collected on successive days and crushed in lysis buffer, containing 125 mM Tris pH 8.0, 4 M urea, 2% SDS, and 5% β-mercaptoethanol (1 ml per insect).
Related posts: