Genotype of B6.129S2-Airetm1.1Doi/J mice was confirmed using two specific polymerase chain reaction (PCR) reactions on tail clippings Linsitinib cost as previously described.12 Briefly, two PCR reactions were performed with the following primers: Set 1-GTCATGTTGACGGATCCAGGGTAGAAAGT and AGACTAGGTGTTCCCTCCCAACCTCAG; Set 2-ATAGCACCACGACACCCAAG
and ATATCATTCTCCAACTCCTGCCTCTTT. In wild-type mice, the first set of primers results in an amplicon of 1150 bp, whereas in knockout mice a fragment of 690 bp is produced. The second set of primers generates a product of 507 bp in wild-type mice, whereas in knockout mice for the Aire gene no amplicon is produced. Surgical castration of 3-week-old male C57BL/6 mice was performed by Charles River, Canada. A group of castrated C57BL/6 mice received subcutaneous 90-day timed-release pellets (Innovative Research of America, FL) containing E2 (17β-estradiol) (1.5 mg/pellet), which reproduces murine physiological levels.13 These pellets were implanted every 90 days for the duration of the study. Experimental AIH was induced in mice by xenoimmunization as previously described.9, 11 Briefly, C57BL/6 or B6.129S2-Airetm1.1Doi/J mice (male or female at 4, 7, or 14 weeks of age) were injected in the tibialis cranialis muscle with 100 μg (50 μL) of plasmids coding for type 2 AIH human autoantigens and murine interleukin (IL)-12 (pRc/CMV- CTLA-4-CYP2D6-FTCD and pVR-IL12)9, 11 dissolved
in saline buffer. Mice were injected three times, at 2-week intervals. Control DNA Synthesis inhibitor mice were injected with the pVR-IL12 plasmid only (100 μg, 3 times). All plasmids were propagated in Escherichia coli by standard techniques and purified using QIAGEN Endofree Plasmid Giga Kit (QIAGEN, Santa Clarita, CA), according to the manufacturer’s guidelines. Serum alanine Phospholipase D1 aminotransferase
levels were measured in a Beckman-Synchron CX9 apparatus, from blood samples taken every month after the last plasmid injection. Mice were sacrificed, and their livers were dehydrated, embedded in paraffin, sectioned, and stained with hematoxylin-phloxine-safran. Enzyme-linked immunosorbent assay was performed as described.9, 11, 14 Briefly, the fusion protein produced by the pMAL-cR1-CYP2D6-FTCD plasmid (human FTCD and CYP2D6) or pEt-30C-mFTCD (murine FTCD) or pEt-30c-CYP2D9 (murine member of the P450 2D subfamily homologous to human CYP2D6) were purified and used as antigen in the enzyme-linked immunosorbent assay (0.2 μg/well). An antiserum was considered positive if its specific OD was at least 2 times higher than the mean optical density of the preimmune mice sera. Proteins expressed from the pMAL-cR1-CYP2D6-FTCD or pEt-30C-mFTCD vector were separated by electrophoresis on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto nitrocellulose filters (Amersham Life Sciences, Oakville, Canada).
Related posts:
- Unlike WT mice and hnRNP F Tg mice, renal structural harm was evi
- Eight-week-old female BALB/c mice (5 per group) were vaccinated w
- Constant with our hypothesis, we’ve demonstrated that mice with elevated lysosom
- The speedy correction of the cognitive deficit in these mice, ages 5 to sixteen
- Confirmed rebound should be addressed promptly to prevent the neg