Cohort studies have suggested that the majority of mothers taking

Cohort studies have suggested that the majority of mothers taking the standard adult dose, even with the capsule formulation, have adequate trough concentrations and achieve an effective virological response [117]. The plasma concentrations of saquinavir achieved with the tablet formulation

when boosted by ritonavir appear to be generally therapeutic and no dose adjustment is routinely required. Interpatient check details variability during pregnancy is, however, high [80],[118]. A study from Italy reported similar third-trimester and postpartum atazanavir concentrations at standard 300 mg dose with 100 mg ritonavir once daily [119]. However, recently third-trimester 24 h AUC concentrations 28% lower than postpartum concentrations were reported from North America. Third trimester concentrations of atazanavir in women taking tenofovir were lower still, being approximately 50% of the postpartum values of women on atazanavir without tenofovir, and 55% of women in the study taking Olaparib mw tenofovir failed to achieve the target atazanavir concentration. The study authors therefore recommended

that it may be necessary to increase the dose of atazanavir to 400 mg (when given with ritonavir 100 mg once daily) during the third trimester [120]. Data from the Europe-based PANNA study also reveals a 33% reduction in third-trimester AUC and Clast atazanavir concentrations compared with postpartum. However, all drug concentrations measured, including with coadministered tenofovir, were above the recommended minimum plasma concentration for wild-type

virus [121]. When prescribed with zidovudine/lamivudine, plasma concentrations achieved with atazanavir 300 mg plus ritonavir 100 mg once daily are only 21% less (by AUC) than historic controls while trough concentrations were reported to be comparable with these controls. Increasing the dose of atazanavir to 400 mg daily during the Quinapyramine third trimester increased trough concentrations by 39% and doubled the risk of hyperbilirubinaemia [122]. A case note review of 155 women in London receiving atazanavir did not report virological failure during pregnancy despite 96% receiving standard dosing of 300 mg with ritonavir 100 mg. TDM was rarely performed and mostly if virological control was considered suboptimal [79]. For darunavir, a study from the USA reported reduced troughs and AUC24 h with once-daily dosing in pregnancy, while dosing twice a day produced levels more comparable with those in non-pregnant individuals [123]. They concluded that twice-daily dosing should be used in pregnancy and higher doses may be required. For women receiving darunavir/ritonavir 800/100 mg the mean trough level (C24 h) in the third trimester and postpartum was 1.37 (0.15–3.49) μg/mL and 2.59 (<0.09–3.96) μg/mL respectively.

Posted in Antibody | Leave a comment

, 2000) Diverse plasmid content of these strains has been identi

, 2000). Diverse plasmid content of these strains has been identified previously (Kuntová et al., 2012). Other strains used in transduction experiments were methicillin-resistant S. aureus (MRSA) isolate Jevons B obtained from Dr. G. Pulverer (Hygiene-Institut, Köln, Germany) and laboratory strain RN4220 kindly provided by Prof. F. Götz (University of Tübingen, Germany). For transduction purposes with induced phage lysate, the lysogen of 07/759 was constructed by inserting φJB (see below)

into its chromosome as previously reported (Borecká et al., 1996). All clinical strains and their characteristics are listed in Table 1. Two transducing bacteriophages, φ80α (Novick, 1963) obtained from Dr C. Wolz (University of Tübingen) and φJB Daporinad price induced by UV light from the MRSA strain Jevons B in this work, both of serological group B from the Siphoviridae family, were employed as mediators Midostaurin for plasmid transfer. Bacteriophage φJB has been deposited in the Czech Collection of Microorganisms under designation CCM 7872. The recipient strain was grown overnight to the titer of approximately 3 × 108 CFU mL−1 in meat peptone broth prepared from 13.0 g of nutrient broth CM1 (Oxoid, Basingstoke, UK), 3.0 g of yeast extract powder L21 (Oxoid), and 5.0 g of peptone L37 (Oxoid) dissolved in distilled water to

1000 mL (pH 7.4). Calcium chloride was added to final concentration 2 mM, and the culture was mixed with stock phage lysate so the multiplicity of infection was below 1. The mixture was shaken moderately at 37 °C for 25 min. Sodium citrate was then added to the mixture Y-27632 2HCl to final concentration 15 mM, and cells were centrifuged at 1100 g for 15 min. The cell pellet was resuspended in 1 mL of sodium citrate (17 mM), and the cells were spread onto agar plates (nutrient agar CM3; Oxoid) supplemented with sodium citrate (20 mM) and Cd(NO3)2·4H2O (final concentration 50 μM) or tetracycline (5 μg mL−1).

The plates were incubated at 37 °C for 48 h. The colonies of transductants were picked up and passaged successively through selective medium with sodium citrate (as described above), nonselective medium with sodium citrate and nonselective medium without sodium citrate. Finally, cells were resuspended in Hogness modified freezing medium (3.6 mM K2HPO4, 1.3 mM KH2PO4, 2 mM sodium citrate, 1 mM MgSO4·7H2O, 4.4% (v/v) glycerol) and stored at −80 °C. The transduction frequency was calculated as the ratio of the number of transductants (CFU) obtained to the number of plaque-forming units (PFU). To obtain induced phage lysates for transduction purposes, the lysogenic strains were precultivated in meat peptone broth at 37 °C with aeration after cells had reached logarithmic growth phase. Twice-washed cells resuspended in 10 mL saline solution (0.85% NaCl) to optical density OD600 nm = 0.15 were irradiated using a 15-W ultraviolet lamp at distance 60 cm for 30 s. The following steps were performed as described previously (Duval-Iflah, 1972).

Posted in Antibody | Leave a comment

, 2009), these three pathogens all declined substantially within

, 2009), these three pathogens all declined substantially within 24 h no matter how they responded to pH initially. Only a small population of these pathogens can survive longer. This suggests that populations of these pathogens may decline depending upon the time required to spread. Thus, extending their time in water by locating the pump house far from the runoff entrance may

mitigate the dispersal of these three pathogens via recycled irrigation water (Hong et al., 2003). Third, extended survival of a small population of all these pathogens occurred over a broad pH range through the formation of compact hyphae. These structures may be important for the survival of these pathogens in aquatic environments because they were long lasting and formed secondary sporangia that can lead to new cycles of zoospore production. On the other hand, these structures are likely to settle out AUY-922 cost of the water column over time because they probably are heavier than individual zoospores or cysts. During sedimentation, they could be subject to degradation by other microorganisms in the sediments. Based on this, the addition of selleck chemical a sedimentation or retention pond to recycling systems may be an additional means of preventing

them from being dispersed to crops in recycled water. Differences in pH responses also are present among these three pathogens. First, P. alni had quite distinct zoospore behavior at initial exposure compared with P. kernoviae and P. ramorum. Its zoospores remained motile for at least 24 h at pH 5–9, which may allow sufficient time for it to spread actively. In contrast, zoospores of P. kernoviae and P. ramorum encysted rapidly irrespective of pH. Although they lose the advantage of spreading actively when they encyst, they may gain a form of resistance against environmental stress.

Phosphatidylethanolamine N-methyltransferase Such resistance may allow these pathogens to survive longer or to be carried away effectively by water currents. Phytophthora nicotianae has been shown to survive better with cysts formed when pressurized CO2 was applied (Ahonsi et al., 2010). Secondly, the extended survival of these pathogens in response to pH is divergent from initial survival. Phytophthora alni and P. ramorum became more tolerant of basic pHs. Basic pH is widespread in nursery irrigation water reservoirs, typically found during summer days because of photosynthetic activity of algae and other aquatic plants (Chen et al., 2003; Cirelli et al., 2008; Hong et al., 2009). Seasonal and diurnal fluctuation of pH in irrigation water ponds based on our most recent observations can range from low pH 6 to close to pH 11. However, such fluctuation is unlikely to become an issue for the survival of these pathogens in irrigation water systems because they can survive well at pH 5–7 despite the fact that only a small population of them can survive long. More concern should be given to P.

Posted in Antibody | Leave a comment

, 2001), competition (Dutton & Evans, 1996), and pathogenicity (r

, 2001), competition (Dutton & Evans, 1996), and pathogenicity (reviewed by Dutton & Evans, 1996; Hegedus & Rimmer, 2005). Despite the important functional roles for oxalic acid in microorganisms, the mechanisms regulating the production of this acid remain largely unknown. Thus far, there have been two reports of a biosynthetic gene identified from fungi (Pedersen et al., 2000; Han learn more et al., 2007), but none

from bacteria. Difficulties have been encountered in deciphering the multiple oxalic acid biosynthetic activities identified (Akamatsu et al., 1991; Akamatsu & Shimada, 1994; Tokimatsu et al., 1998), purifying the biosynthetic activities (Li et al., 1999) and ultimately the genes that encode them. Efforts to understand this biosynthetic pathway(s) would greatly benefit from the identification and isolation of the molecular components required for its production. Thus, we adopted a molecular-genetic approach to complement the existing biochemical methodologies. Burkholderia glumae was chosen as the model organisms for this endeavor because it is a simple

bacterium, produces ample amounts of oxalate, is amenable to molecular-genetic techniques (Nakata, 2002), has an established biochemical assay for oxalic acid biosynthesis (Li et al., 1999), a recently sequenced genome (Lim et al., 2009), and is an economically important phytopathogen. Burkholderia glumae is the known causal agent of bacterial panicle blight and PD0325901 seedling rot in rice (Tsushima et al., 1996; Song & Kim, 1999; Nandakumar et al., 2009) as well

as bacterial wilt in a number of crop plants (Jeong et al., 2003; Lim et al., 2009). As a first step toward elucidating the regulatory mechanisms of oxalic acid biosynthesis, here, we report the identification and isolation of the first set of oxalic acid biosynthetic genes from bacteria. We refer to these new genes as oxalate biosynthetic component (obc)A and obcB, both of which are essential for elevated oxalic acid production in Metalloexopeptidase B. glumae. Transcript analysis showed that both genes are encoded in a single polycistronic message, forming, at least in part, an oxalic acid biosynthetic operon. Burkholderia glumae (ATCC no. 49703, Manassas, VA) as well as strains of Escherichia coli [DH5α, Invitrogen Life Technology, Carlsbad, CA; BLR (DE3), EMD Biosciences Inc., Madison, WI] were grown in Luria–Bertani broth (LB) (Invitrogen Life Technology) media at 30 °C. If required, 50 μg mL−1 of the appropriate antibiotic was added. A transposon-mutagenized B. glumae library was generated as described previously (Nakata, 2002), with the exception that the EZ∷TN™〈KAN-2〉 (Epicentre, Madison, WI) rather than the EZ∷TN™〈R6K-γori/KAN-2〉 was used to create the insertion mutants. Individual colonies were selected and used to inoculate 1 mL of LB. The cultures were grown to saturation (1–2 days) at 30 °C with shaking.

Posted in Antibody | Leave a comment

This specimen was frozen and stored at −20 °C Approximately 1 cm

This specimen was frozen and stored at −20 °C. Approximately 1 cm3 of sponge tissue was excised from the middle of the entire sponge and washed three times with sterile artificial seawater (ASW) (Aquasonic, NSW, Australia). A sponge homogenate was prepared by cutting sponge tissue into small pieces and homogenizing with 5 mL of ASW using a sterile mortar and pestle. Fast-growing mycobacteria were isolated from A. queenslandica, after 100 μL of each of a twofold dilution series of the sponge homogenate (up to 1/16 dilution) was inoculated onto a glycerol–asparagine medium consisting of 10 mL of glycerol, 1.0 g of l-asparagine, 1.0 g of K2HPO4, 16.6 g of artificial sea salts, 9.0 g

of Davis agar, and 1000 mL of distilled water, followed by incubation at 28 °C. This medium was supplemented with buy FDA-approved Drug Library 50 μg mL−1 of cycloheximide and 20 μg mL−1 of nalidixic acid to inhibit the growth of fungi and fast-growing bacteria. Colonies appearing after 3 weeks were picked for single-colony purification. Salinispora strains were isolated from homogenates of A. queenslandica using starch–yeast extract–peptone (SYP) medium and the method described by Kim et al. (2005), with the

exception Ibrutinib clinical trial that the pH of the medium was not adjusted. Some of the Mycobacterium strains were also isolated using this method. A slow-growing Mycobacterium species was isolated from Fascaplysinopsis sp. using a low-nutrient broth enrichment medium consisting of 0.001% peptone, 0.001% yeast extract, 0.001%d-glucose, 20 mL

of Hutner’s basal salts (Schlesner, 1994), 10 mL of vitamin solution no. 6 (Schlesner, 1994), 5 mL of 0.1 M Tris/HCl buffer (pH 7.5), and 1000 mL of ASW. Fifty milliliters of the low-nutrient broth enrichment medium supplemented with 50 μg mL−1 of cycloheximide and 500 μg mL−1 of ampicillin in a 250-mL Erlenmeyer flask was inoculated with 1 mL of homogenate of Fascaplysinopsis sp. and incubated on a rotary shaker (260 r.p.m.) at 28 °C in the dark for 1 month. STK38 Subsequently, a portion of this broth enrichment was plated on 1/10 strength Marine 2216 medium supplemented with 50 μg mL−1 of cycloheximide and 200 μg mL−1 of ampicillin. Colonies appearing after 2 months were purified using the single-colony subculture technique on the same medium. Genomic DNA was extracted from the isolates using a Wizard® Genomic DNA Purification Kit (Promega, WI) with the recommended protocol for Gram-positive bacteria. The 16S rRNA gene sequence was amplified with the 27f (AGAGTTTGATCMTGGCTCAG) and 1492r (TACGGYTACCTTGTTACGACTT) primer set. In addition to the 16S rRNA gene, rpoB and hsp65 genes were analyzed to determine their evolutionary relationship within the genus Mycobacterium. Amplification of the hsp65 gene was performed with the primers Tb11 (ACCAACGATGGTGTGTCCAT) and Tb12 (CTTGTCGAACCGCATACCCT) (Telenti et al.

Posted in Antibody | Leave a comment

By contrast, in the SCZ of wild-type (WT) mice, only a few immatu

By contrast, in the SCZ of wild-type (WT) mice, only a few immature (but no mature) newly generated neurons were observed, suggesting that virtually all postnatally

generated immature neurons in the SCZ were eliminated by Bax-dependent PCD. Treatment of 2-month-old WT mice with a caspase inhibitor, or with the neurotrophic factor Small Molecule Compound Library brain-derived neurotrophic factor, promoted the survival of adult-generated neurons, suggesting that it is the absence of sufficient neurotrophic signaling in WT SCZ that triggers the Bax-dependent, apoptotic PCD of newly generated SCZ neurons. Furthermore, following focal traumatic brain injury to the posterior brain, SCZ neurogenesis in WT mice was increased, and a subset of these newly generated neurons migrated toward the injury site. These data indicate that the adult SCZ maintains a neurogenic potential that could contribute to recovery in the brain in response to the injury-induced upregulation of neurotrophic signaling. “
“The subcortical projections to the marmoset frontal pole were mapped with the use of fluorescent tracer injections. The main thalamic learn more projections, which originated in both the magnocellular and parvocellular subdivisions of the mediodorsal

nucleus, were topographically organized. Our results suggest the existence of a third, caudal subdivision of this nucleus, which is likely to be homologous to the macaque’s pars densocellularis. A substantial, but not topographically organized, projection to Brodmann’s area 10 originated in the medial part of the ventral anterior nucleus. Minor thalamic projections originated in the medial pulvinar nucleus and in the midline/intralaminar nuclei. Finally, the posterior thalamic group (including the limitans and suprageniculate nuclei) sent a small projection to rostral

area 10 that has not previously been documented in primates. The main extrathalamic projections stemmed from the claustrum, which contained as many as 50% of all subcortical labelled Clomifene neurons. Minor connections originated in the hypothalamus (mainly in the lateral anterior and lateral tuberal regions), dorsal periaqueductal grey matter, basal forebrain (nucleus basalis of Meynert and horizontal limb of the diagonal band of Broca), and amygdala (basal, accessory basal and lateral nuclei). The present results, combined with recent data on the cortical projections to area 10, reveal the frontal pole as a region that integrates information from multiple neural processing systems, including high-level sensory, limbic and working memory-related structures. Although the pattern of subcortical projections is similar to that previously described in the macaque, suggesting a homologous organization, the present data also suggest functional distinctions between medial and lateral sectors of area 10.

Posted in Antibody | Leave a comment

Some patients with task-specific musician’s dystonia, for example

Some patients with task-specific musician’s dystonia, for example, train to be ‘unfocused’ while practising their instrument, because this technique might lead to improvement of symptoms during playing. There have been a large number of studies of the effects

of attention on sensory systems. click here In general, they show that attention to a stimulus of a given modality that is presented at an expected location and time increases the activity evoked in the brain. This occurs mainly in the appropriate primary sensory area of the cortex, together with activity in frontoparietal association areas. The latter is seen during attention to any modality of sensation and may represent a control network for attentional focussing (Behrmann et al., 2004; Ptak, 2012). As a preventative method and for ‘healthy’ training of musicians, techniques of systematic variation of the locus of attention are used, such as focussing on external (usually tactile) stimuli or diversion away from the fingers involved in the task to distant body parts buy Epigenetics Compound Library such as the legs or feet (Loosch, 2004). In contrast to its positive effects on sensory function, attention to movement is often viewed as a negative factor. The sports training literature emphasizes the importance of the focus

of attention; attention to movement itself (an ‘internal’ focus) may interfere with optimal performance, whereas attention to the consequences of the action (an ‘external’ focus) may be helpful (Wulf & Prinz, 2001). The same may be true in people with disorders of movement, for example task specific musician’s dystonia. A similar balance between types of attention has been proposed to occur during motor learning. It is a common

experience that, if attention is diverted away from a task, learning is generally poorer (Song, 2009). However, excessive focus on the details of a task can be associated with poor performance (Nideffer, 1976) and perhaps even development of O-methylated flavonoid a task-specific movement disorder (McDaniel et al., 1989; Sachdev, 1992; Adler et al., 2005). It has been suggested that there are two distinct systems, an attentional (conscious control) and a non-attentional (subconscious) system, that operate during motor learning (Hazeltine et al., 1997; Blischke & Reiter, 2002), and that engaging both systems in the correct proportions during training leads to efficient motor learning. Learning suffers when there is too much conscious attention to details of the task. A comparison of the activation patterns of healthy professional guitar players and those with task-specific dystonia demonstrated that, in healthy players, a switch between systems compatible with the two systems was far more balanced (Pujol et al., 2000). In healthy humans the impact of attention seems less obvious. There have been few investigations into the physiological consequences of attention on the motor system (see, for examples: Noppeney et al., 1999; Johansen-Berg & Matthews, 2002; Rowe et al., 2002; Thomson et al., 2008).

Posted in Antibody | Leave a comment

If the source patient is found to

If the source patient is found to MAPK Inhibitor Library be HIV negative, PEP can be discontinued. If the source is known to be HIV positive, the event is assessed to determine the degree of exposure according to standard Centers for Disease Control (CDC) guidelines.8 With a low-risk exposure,

a basic two-drug PEP regimen is initiated. With a high-risk exposure, lopinavir/ritonavir is added to the basic regimen. Residents and students with an exposure are required to undergo both follow-up testing at predetermined intervals and postexposure counseling. A survey of medical schools in the UK found that 91% (20 of 22) had provided information on occupational exposure to HIV to their students, but only 2 (9%) had PEP available for students on overseas electives.14 The few schools that have reviewed their experiences provide useful information on the challenges associated with HIV PEP for traveling medical trainees. For example, at Dundee University in the UK, medical students attend a seminar and are offered free starter packs of ART prior to their international rotations.15 Of the 140 students who went abroad in 1 year, only 22 (16%) carried starter packs of zidovudine

with them. A survey conducted by Dundee University found that 74% (76 of 103) of medical students indicated they had participated in exposure-prone procedures such as surgery or phlebotomy including 38 who had significant exposures, ie, percutaneous, mucous membrane, and nonintact skin contamination. However, only six students considered taking PEP, and ultimately Panobinostat none of the students used PEP. At Guy’s, King’s College, and St Thomas’s School of Medicine in London, medical students are encouraged to pursue electives abroad.16 Students Amino acid have access to clinical advisors who offer academic advice and information on international clinical electives. In addition, students receive a regularly updated policy on avoiding blood-borne pathogens, minimizing risk, postexposure advice, and access to a consultant virologist. Students traveling to areas with a high HIV prevalence are prohibited from participating in high-risk activities (eg, obstetric/gynecology, surgery) and are offered

a 6-day starter pack of zidovudine as monotherapy for 40 pounds (∼US$ 80). Overall, 44% (65 of 148) of students visited areas with moderate to high HIV prevalence. Twenty-seven of these students were unaware of the HIV risk. Of the remaining 38 students, only 25 (66%) had been directly advised on the potential risk of blood-borne pathogens, 13 (34%) carried a PEP starter pack, 24 (63%) purchased a medi-kit, and 20 (53%) took latex gloves with them. Students who were unaware of the HIV prevalence in the areas they visited were less likely to have discussed exposure risk or traveled with a starter pack, a medi-kit, or latex gloves. These institutions have taken the lead in providing for their students and have made strides in developing a system for educating students.

Posted in Antibody | Leave a comment

Only 25% of these travelers had prior HBV screening, and 11% were

Only 25% of these travelers had prior HBV screening, and 11% were tested in clinics. These clinic visits thus represent opportunities to improve testing for at-risk travelers with unknown HBV status.

Regarding HBV-susceptible patients, we found that testing in a travel clinic led to a higher rate of hepatitis B immunization than past testing did. Moreover, travel clinic testing showed that 3.3% required further evaluation and monitoring for chronic HBV infection, and 59% were candidates for vaccination, representing unmet health needs in this population. The difference between HBsAg positivity rates in travel clinic CH5424802 research buy tests and past tests (3.3% vs 7.3%) is attributed to the expanded risk definition (testing persons from countries with HBsAg prevalence ≥2% vs ≥8%, respectively). We found low HBV immunization rates among US-born travelers planning to visit HBV-endemic countries as well as among travelers born in HBV-risk countries. Travel clinics target highest-risk travelers for HBV immunization, such as those planning long stays, close contact with the local population, or activities with possible blood and body fluid exposure despite current recommendation to immunize all such travelers. The low HBV immunization rates indicate that the travel clinic is an underutilized setting

for immunizing travelers to HBV-risk countries. The tests utilized varied widely. HBsAg and MYO10 anti-HBs were requested more frequently, probably because they establish infection/carrier selleck inhibitor state and immunity. Anti-HBc was performed least frequently, likely because the multiple possible interpretations of a positive anti-HBc are confusing, and the travel clinics having a single encounter with the patient prefer data that lead to

clear action steps. Simple and straightforward guidance on specific tests to be performed should be incorporated into HBV screening recommendations, as highlighted by an Institute of Medicine (IOM) committee report.[4] For simplicity and clarity of interpretation, we advocate HBsAg and anti-HBs as routine tests for individuals born in countries with HBsAg prevalence ≥2%. The addition of anti-HBc is valuable in interpreting serologic tests, as an indicator for possible HBV infection.[6] These results resonate with other HBV serosurveys on immigrants, where HBV prevalence in foreign-born persons reflected the prevalence in their countries of origin.[7, 20] Likewise, the proportion of travelers born in HBV-risk countries may vary by clinic, depending on the composition of the population in the catchment area. Recommendations derived from our analysis are especially relevant to primary care practices and travel clinics in geographic areas with large immigrant populations.[21] The association of HBV testing in the clinic and advice to immunize suggests an additional benefit of HBV screening in travel clinics.

Posted in Antibody | Leave a comment

The objective was to determine student opinions on the value of P

The objective was to determine student opinions on the value of PBL and the PBL learning process at one UK school of pharmacy. Utilising the professional accreditation criteria small molecule library screening for UK schools of pharmacy a questionnaire was devised and piloted before being given to all UEA undergraduate pharmacy students for self-completion. The most appropriate method of dissemination was determined

from a student-led focus group. A total of 201/329 (61.1%) students responded. The majority of students agreed that PBL improved their team working (83.1%), oral communication (89.1%) and problem-solving skills (61.7%). Additionally PBL improved students’ ability to identify and address ethical dilemmas (74.5%) as well as enhancing their ability to manage their own learning (67.6%). Male students and those with a stated preference for team working were found to prefer PBL. Students generally believe that PBL develops a number of key skills and consequently inclusion of PBL alongside traditional teaching methods enables the school to meet a number of degree accreditation criteria. Male students, those who enjoyed team working and working with their current group were more positive about PBL. Further work is required to improve the experience for all students. “
“Objectives  Herbal medicines and other

natural health products (NHPs) are sold in Canadian pharmacies as over-the-counter products, yet there is limited information on their safety MI-503 and adverse effect profile. Signals of safety concerns associated with medicines can arise through C1GALT1 analysis of reports of suspected adverse drug reactions (ADRs) submitted to national pharmacovigilance centres by health professionals, including pharmacists and the public. However, typically such systems experience substantial under-reporting for NHPs. The objective of this paper is to explore pharmacists’ experiences with and responses to receiving or identifying reports of suspected ADRs associated with NHPs from pharmacy customers. Methods  A qualitative study in which in-depth, semi-structured interviews were conducted with 12 community pharmacists in Toronto,

Canada. Key findings  Pharmacists generally did not submit reports of adverse events associated with NHPs to the national ADR reporting system and cited several barriers, including lack of time, complexity of the reporting process and lack of knowledge about NHPs. Pharmacists who accepted responsibility for adverse event reporting appeared to have different perceptions of their professional role: they saw themselves as ‘knowledge generators’, contributing to overall healthcare knowledge. Conclusions  Reporting behaviour for suspected ADRs associated with NHPs may be explained by a pharmacist’s perception of his/her professional role and perceptions of the relative importance of generating knowledge to share in the wider system of health care.

Posted in Antibody | Leave a comment