g for the Y-27632 146986-50-7 following covariates: lactate dehydrogenase vs o2 ULN, BRAF mutational status by cfDNA, World Health Organization performance status and tumour type. To assess whether allowing cfDNA detected BRAFt patients into a selected trial would result in the study population being enriched for patients with differing prognoses from the main study population, analyses were carried out using patients who were BRAFt by tumour but with serum results also available. A univariate analysis was carried out to compare PFS between patients who were BRAFt in serum and patients in whom BRAF mutations were not detected. In addition, summary 2 2 tables were produced to assess a potential correlation between BRAFt, as detected by cfDNA, and the known prognostic factor LDH.
Table 1 Primer and probe sequences GDC-0941 957054-30-7 ARMS assay ARMS primer Common primer TaqMan probe Size BRAF for FFPE 1799T4A AAAAATAGGTGATTTTGGTCTA GCTACATA TAGTTGAGACCTTCAATGACTTT CTAGTAA Yakima Yellow AATCTCGATGGAGT GGGTCCCATCAGTTTGAACA Bhq 179 Control for FFPE AGGACACCGAGGAAGAG GACTT GGAATCACCTTCTGTCTTCATTT Cy CCATCTTCTTCCTGCCTGATGA GGGGAAA Elle 252 BRAF for cfDNA AAAAATAGGTGATTTTGGTCTA GCTACATA CATCCACAAAATGGATCC AGACAA Yakima Yellow GATGGAGTGGGTC CCATCAG Bhq 91 Control for cfDNA CTCCAGATCTCAGTAAGG TACGG GGGAAAGAGTGGTCTCTCATC Cy5 CATGAAGAGATTAAT GGCAGAGTGCC Elle 101 Abbreviations: ARMS¼Amplification Refractory Mutation System, cfDNA¼circulating free DNA, FFPE¼formalin fixed paraffin embedded tissues. Detection of BRAF mutations in tumour and serum samples RE Board et al 1726 British Journal of Cancer 101, 1724 1730 & 2009 Cancer Research UK Molecular Diagnostics LDH levels were available for 190 of the 200 patients enrolled into the study.
RESULTS Assessment of BRAF assay sensitivity Using the cell line HT29, several serial dilution studies of HT29 DNA in human genomic DNA were performed to determine the sensitivity of the BRAF ARMS assay. The BRAF mutant could be detected at a level as low as 5 copies of HT29 DNA in a background of 5000 copies of wild type DNA. BRAF p.V600 mutation detection in clinical samples Of the 200 patients enrolled in the trial, 176 tumour samples were obtained, 163 samples were FFPE and the remaining 13 were fresh frozen specimens. Of the 176 tumour samples analysed, 158 generated acceptable ARMS results. DNA sequence data for BRAF were obtained for 147 tumour samples.
In total, 70 BRAF mutations in tumour DNA were identified by ARMS. Of the BRAF mutations detected by ARMS, five were determined by sequencing to be complex g.1798 1799GT4AA changes resulting in a BRAF p.V600K alteration, rather than the more common p.V600E. Sequencing detected two samples with additional mutation types that could not be captured using the specific ARMS assays in this study: BRAF g.1742A4T and g.1801A4G. Eighteen mutations were detected by ARMS but failed DNA sequencing because of low DNA yields, indicating that ARMS is the more robust method, particularly for analysis of DNA extracted from FFPE specimens, although confined to detecting known mutations. Of the 96 tumour samples available from patients with cfDNA data, 45 were detected to be BRAFt by ARMS. Sequencing had confirmed these mutations to be p.V600E in 42 cases and p.V600K in 3 cases. A further tumour sample was shown to harbour a p.K601E mutation, which was not detectable by the ARMS assay design. Serum samples were available for 126 of the 200 patients enrolled in study D1532C00003, cfDNA was extracted from samples as
Related posts: