Cells were then incubated with magnetic beads covered with goat anti-rat IgG (Qiagen, Hilden, Germany) before magnetic separation. After washing steps, cells were then suspended in RPMI1640 supplemented with 4 mg/mL fatty acid-free bovine albumin (Sigma). The same medium was used to prepare S1P (Sigma) at 10−8 M or CCL2 at 50 ng/mL (R&D systems).
Cell migration was measured in Transwell chambers (Costar, Cambridge, MA, USA) with 5-μm pore-width polycarbonate filters. After 2 h, transmigrated cells were stained for CD3, NK1.1, CD27 and CD11b or CD11b, Ly6G and Ly6C and counted by flow cytometry as described previously [16]. Lymphocyte or monocyte subsets stained with the appropriate antibodies were sorted using a FACS Aria cell sorter (Becton Dickinson). RNA was extracted with the RNeasy micro kit (Qiagen), which includes treatment with DNase I. We see more used Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) to generate cDNA for RT-PCR. PCR was carried out with a SybrGreen-based kit (FastStart Universal SYBR Green Master, Roche, Basel,
Switzerland) on a StepOne plus instrument (Applied biosystems, Carlsbad, CA, USA). Primers were designed using the oligoperfect software (Invitrogen, Carlsbad, CA, USA). The following primers were used: S1pr1 (F: AAATGCCCCAACGGAGACTCTG, R: TTGCTGCGGCTAAATTCCATGC), S1pr2 (F: CCCAACTCCGGGACATAGA, R: ACAGCCAGTGGTTGGTTTTG), S1pr3 (F: TCAGTGGTTCATCATGCTGG, R: CAGGTCTTCCTTGACCTTCG), S1pr4 (F: AAGACCAGCCGTGTGTATGG, learn more R: TCAGCACGGTGTTGAGTAGC), S1pr5 (F: GCCTGGTGCCTACTGCTACAG, R: CCTCCGTCGCTGGCTATTTCC), Gapdh (F: GCATGGCCTTCCGTGTTC, R: TGTCATCATACTTGGCAGGTTTCT). S1PR expression level in the different cell subsets was normalized to GAPDH expression levels. Ly6C− monocytes were sorted by flow cytometry using a FACS Aria cell sorter (Becton Dickinson). They were cultured Isoconazole in flat bottom 96 well plates (25000/condition) in duplicates. For cultures with M-CSF, the culture medium was supplemented with 10% FCS in the presence or absence of 5% of an M-CSF-containing cell culture supernatant.
In some experiments, cells were resuspended in medium supplemented with 4 mg/mL fatty acid-free bovine albumin (Sigma). The same medium was used to prepare S1P (Sigma), which was added or not to the cultures at a concentration of 10−6 M. Statistical analyses were performed using two-tailed t-tests or nonparametric tests when appropriate. These tests were run on the Prism software (GraphPad, La Jolla, CA, USA). Levels of significance are expressed as p-values (*p < 0.05, **p < 0.01, ***p < 0.001). Authors thank the Plateau de Biologie Expérimentale de la Souris, and the flow cytometry facility of the SFR Biosciences Gerland. We also thank Andrew Calver (GlaxoSmithKline) for providing S1PR5 KO mice and Steffen Jung for the CX3CR1gfp/gfp mice. The T. W.
Related posts:
- Transduced cells were then incubated
- 2 μl of a 1% solids NP solution, and incubated at room temperatur
- Magnetic motor threshold and the power of stimulation Magnetic mo
- Cells have been incubated while in the presence of AZD6244 for 96 hrs at concent
- Methods Cells and cell culture LNCaP human prostate cells, obtain