NART methods physeal St changes Hypoxia and determination

E differentiation, hypoxia, HIF-1 gene NART expression and VEGF and Flk itsreceptor 1, we were able to establish, for the first time, the R Of Hsp90 in the differentiation and growth plate vascularization. Materials and methods physeal St changes Hypoxia and determination. Days of the male broiler chicks were obtained in battery brooders to 24 Ht. Dyschondroplasia was thiram food to 40 ppm in the diet from day 3, rickets and vitamin D-di-t induced from day 1 after hatching. The development of TD-L emissions Was examined for 10 days. Hypoxia growth plate was prepared by in situ injection Hypoxyprobe in the wing vein at 40 mg / examined kg, as described above. In the Press Prevention protocol was TD containing 40 ppm thiram Di T tet were at the door to 4 days in 10 days, when the chicks get Induced. The geldanamycin analogue 17 17 demethoxygeldanamycin, a specific inhibitor of Hsp90 activity was t in the wing vein and administered on day 3 day 5. Rickets, Di Vitamin D-induced t out of the hatch after the first day and 17 DMAG was administered on days 3 and 7, and get the chicks were on day 12 Tet. In the treatment protocol, TD by a di t, the 25 ppm thiram was induced, 17 DMAG on days 7, 10 and 12 after hatching, the chicks was get Tet and administered on day 14. All chicks contr Were the Salzl Administered solution. This dose was based on studies of mice with 17 prevent DMAG on tumor development at M Weight Hlt. The protocol for all animal experiments was submitted to and approved by the Volcani Center Institutional Committee for the Care and Use of Laboratory Animals. The growth plate sections, immunohistochemistry and in situ hybridization. Immediately after death by cervical fracture of the tibia were fixed in 4% paraformaldehyde. Immunohistochemistry was with VEGF147 and Flk polyclonal rabbit antibody Body 1, HIF-1 mouse monoclonal, monoclonal posted to this body and smooth muscle actin. Alkaline phosphatase-F Staining was performed as described above. For in situ hybridization, the avi Used Ren PTH / PTHrP receptor type II collagen and probes.
Concentrations of VEGF and Flk 1 were analyzed with ImagePro software. Photographs of eight sections of each growth zone from three different chicks of each group were taken for analysis. The results are presented in arbitrary units of means SE. Bone ash, plasma calcium, phosphorus, and the determination 25D3. Calcium and phosphate were was by COBAS INTEGRA 400 plus, calcium ion analyzes of Omni, 25-hydroxyvitamin D3 was analyzed by two-site chemiluminescent test and bone ash was determined as described by Yalcin and analyzed al .. Chondrocytes in culture. Prim Re avi Ren epiphys Re chondrocytes in the growth zone, prepared as described above were incubated for 3 days with 0.5 M 17 17 demethoxygeldanamycin. 17 AAG is highly active in vitro, but a poor pharmaceutical properties, such as L Valproate Solubility, stability t, Hepatotoxizit t, and formulation difficulties, w While 17 DMAG, the lt potent inhibition of Hsp90 beibeh, An L Solubility adduced in water expanded and improved pharmacological profile. The primers for real-time PCR were for HIF 1 5 3 5 3 CCGTCAAATCGAAACAACTTT TGTATGGGACTCACTCAGGTGAA and a glucose transporter, 5 3 May 3rd GAGCCAATGGTGGCGTAGAC GGATCAATGCGGTTTTCTACTACTC The statistical analysis. An ANOVA was used, and how.