Rhizobia were isolated from the soil samples using M. pinnata as a trap crop (Fig. 1, Table 1). Millettia pinnata seeds of single germplasm were surface sterilized using Tween-80 (100 μL L−1) for 10–30 min followed by 0.1% HgCl2 and 70% ethanol for 30 s and washed 4–6 times with sterile distilled water. These seeds were sown in the pots filled with test soil, and the experiment was conducted under glass house conditions. After 90 days of germination, the plants were uprooted carefully, and mature nodules
were collected as explained by Vincent (1970), and rhizobia were isolated using Yeast Extract Mannitol Agar (YEMA) medium containing Congo-red. Single isolated colonies were picked and checked for purity by repeated Everolimus order streaking and by microscopic examination. For confirmation, each isolate was tested individually for nodulation in the host plant. The experiment was conducted in the pots filled with sterile sand. Surface sterilized seeds were sown after germination inoculated with culture broth as described by Vincent (1970). Inoculated plants were grown in a greenhouse at 30 °C during the day and 26 °C during the night. A total of 108
phenotypic features, including utilization of sole carbon (22) and nitrogen sources (6), resistance to antibiotics (9), tolerance to dyes and chemicals, effect of temperature, drought, pH, and salinity on growth and some physiological and biochemical reactions, described previously (Gao et al., 1994) were examined. Colony morphology characters were
find more determined as per Vincent (1970). Mean generation times of the isolates were determined spectrophotometrically (Yelton et al., 1983) in Yeast mannitol broth (Vincent, 1970). The ability to grow in Bringers’ Tryptone Yeast extract (TY), urea hydrolysis, nitrate reduction, and indole acetic acid (IAA) production were assessed according to the methods of Somasegaran & Hoben (1994), Gerhardt et al. (1994), Roussel-Delif et al. (2005) and Huddedar et al. (2002), respectively. Cross nodulation ability of rhizobial isolates was tested as per Vincent (1970) using Vigna radiata, V. mungo, V. unguiculata, Cajanus cajan, Macrotyloma uniflorum, Cicer arietinum, Phaseolus Linifanib (ABT-869) vulgaris, Cyamopsis tetragonolobus, Dolichos lablab, and Arachis hypogaea as host plants. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) (Sneath & Sokal, 1973) was used for clustering analysis of phenotypic features. The mean similarity for each isolate within a cluster was estimated to present the phenotypic variation in the cluster, and a phenogram was constructed by applying coefficient Sj (Sneath & Sokal, 1973). Genomic DNA was extracted using DNA-XPress™ kit (Himedia). Nearly the full 16S rRNA gene was amplified using primers 16SF (AGAGTTTGATCCTGGCTCAG), 16SR (ACG GCT ACC TTG TTA CGA CTT) (Nuswantara et al., 1999) and reaction mixture (50 ng of bacterial DNA, 2.5 mM 10X buffer, 20 pmol primer, 0.
Related posts:
- (soil bacteria not isolated from AMF spores) were used as control
- Analysis of Extracted DNA Samples Samples of DNA were quantitativ
- Aside from soil infertility, drought may be the most significant
- Among these,
the following indicators of forest soil qual - The three soil subsamples collected at 0–10 cm depth at each site